CB304862

Overview
NameCB304862
Unique NameCB304862
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length590
Libraries
Library NameType
Flavedo Maturecdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IaR_B12 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IaR_B12 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304862 ID=CB304862|Name=CB304862|organism=Citrus sinensis|type=EST|length=590bp
TTTTTNNTTTTTTTTTTTTTTTTTTTTTTTGTATAGGTTCCTGAGCCATT
TTATTACTTTTTGAGGGCAACAAAGACGGAACTATGCCTGGTGATGAACT
AACCACTGATACTTCTTCCCTGGGAATGTAATTTGAAACTGAACTAACAT
ATGAATGTGAGGAAACGACATGGTCATTTTCTGACCTTCGAATATTGTCA
ATCTCATTAATCTTTGGCAAAGAGTGATCTCTTTTAATTTTCTGTTCCTT
CGTCGATGCTTCTTTATCCAGAGACCGTATTTTCTCAGATTCTTTTATTT
TATCAGCTAAACTGTCAATTTTCTGTTTAACCTCCTGAGCACATGCTTCG
GAATCATCAGCATGAAAGCCGCTGTACATCTTCTCCTCAGCCAAACCTCC
CTGTTGATTCAGCTGCCCATGGATGGAAATGGGAATGGGAATTACATTTT
CTCCACATGTTGCAAAGTTAGATGGATGAGAACCATAATCATGTTGCAAT
GGAGTAGACAAGGGAGTGGTGCTCTTCACATCTAATGGGGGTAAGCCATC
AGCAGGGACAAANTGGATGATATATGTTGCTTCTCNGCCC
back to top