CB304866

Overview
NameCB304866
Unique NameCB304866
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length105
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9921 contig Csv1_Contig9921:727..831. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IaR_C06 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IaR_C06 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304866 ID=CB304866|Name=CB304866|organism=Citrus sinensis|type=EST|length=105bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCATAAAATAGTAAAATATAT
ATAAGTCCGAGATGCTGTCAACATAAATTTCGTTCAACAGGAGATTGACG
ACACC
back to top