CB304867

Overview
NameCB304867
Unique NameCB304867
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length379
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
CB304867_ssr58 microsatellite CB304867_ssr58:58..69.
CB304867_ssr103 microsatellite CB304867_ssr103:103..118.
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IaR_C08 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IaR_C08 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304867 ID=CB304867|Name=CB304867|organism=Citrus sinensis|type=EST|length=379bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGATAAATAACTAAATTTATT
CCTTTACAAATAAATAAATAAGATAATACGACTACTACATTTATACCTTT
ACAAATAAATAAATAAATGAGCTATAGCAATAATATAACTACTACATTTG
ATGAGATCATCATATGAGAATTAGACGGCTGTAGTATAATGCATCAAAGT
GACATAACGCACCTAATTAAGGCTCAAAAGCTCCTCATTACAAAAATATT
GGGCGGCTAATCAAAGCTCAGAAGGTTCCTCGTATCAGAATTTAACAGAG
CAAAAATGAATTCTTGAAAACAAAACCTCTTCAAAACCCCTCACTCGCCT
TTCTTCACCGCAATCCGCAAGACACTTAC
back to top