CB304872

Overview
NameCB304872
Unique NameCB304872
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length103
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IaR_D01 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IaR_D01 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304872 ID=CB304872|Name=CB304872|organism=Citrus sinensis|type=EST|length=103bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCGACTAAAATAAATACTTCA
AAATTAAACAACACAAGGCCACGGTCCTGGCCATGGCCATATGTTACTTG
ATT
back to top