CB304874

Overview
NameCB304874
Unique NameCB304874
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length534
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13365 contig Csv1_Contig13365:23..549. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IaR_D04 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IaR_D04 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304874 ID=CB304874|Name=CB304874|organism=Citrus sinensis|type=EST|length=534bp
TTTTTTNTTTTTTTTTGTTTTTTTTTTTTTATCTTGCTAANNNTTTCANN
ATATAATTCACAGCTTTGAAGAAATTTGTTACAGCTTTCCCATATTTTAA
GATTTAAATTGTAAAACTAACACTATAGATTCTCTTGTTACAAGAACGTC
AACTAATCCAAAACAAGAAGGCATATTAAAGTAATACAGTTCCTACTCAG
AATGATNNACCAACTTGCCAAAGACAGTACAATGTTATAATTCCATTTCC
TTGACCAAACTGTTCGATTGTTTTTTGTCGCGAGCGTAAGCACATCTACA
AAAGCAGAAAATGATGCACGAAGAAACCTGGCCTCAACTTGCCTCAAAGT
GCACTAAAAGTTTCCCATTAACGACAGATATCTGCCTTTTTCACTTTGTC
TGGTTGCAACTCCTTATCAACAGCTAATGCTGCATACACAATTGATGCAT
TCTCATTTGGACTCGTAATCCACTTCAAAATCACAAATGAATTCCCTTTG
CAATGCATCAGAAGGTAGAGCAGCTTGCCATCAC
back to top