CB304875

Overview
NameCB304875
Unique NameCB304875
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length547
Libraries
Library NameType
Flavedo Maturecdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3479 contig Csv1_Contig3479:405..951. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IaR_D06 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IaR_D06 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304875 ID=CB304875|Name=CB304875|organism=Citrus sinensis|type=EST|length=547bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCAATAATAAGAAATTAA
TATATTTCACTGAGTTTATAACAATAAGTTACATGAAAAATATGTAAGAC
ACCCAGCACACAAGTTGAGTGCAGGGGTTGCCTTTGTTTATTTCAATGAC
TTGATCAATCATTACTCTTATCTATTTCTTACTCAAGCTCATGACTTTTC
AATGACCTTGGCTCTTAAATTTTGTTGTGTTTTGACACAAATCTAAACCT
CTGAGTGAACATTAAAATCAAAAACACGGTTGTGGCAAGTGGGGTTGCAA
GGGTAAGCACAATCTATCTTCTGGAATGGACTTCGGTCGTAATACCAGTC
TCCCACTGCCTTTGCAATTGACATTTTACCCAGCACCGGAGAGTCAGTTC
TTAACCAAGTTTCCTGCATTTCGGTTTGGCAATGGGCATAACAAGCGTCT
ATAAACATCCCTCTGGATGAAGAGATGCCCAGTCCAGCCAATGCATTTAA
GAATTGTGTCCTGAAACTTTGCATTGTTTGCAGCTGAGTAGGTGAGC
back to top