CB304881

Overview
NameCB304881
Unique NameCB304881
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length244
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2589 contig Csv1_Contig2589:764..1007. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IaR_E03 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IaR_E03 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304881 ID=CB304881|Name=CB304881|organism=Citrus sinensis|type=EST|length=244bp
TTTTTTTTTTTTTTCTTTTNNNNTTTTTTTGATTGAATTAAAATTCATTA
AAAAGGACAAATTAAAGAAAACAAAACGACAAAGATTAACAAACGAAACA
AGTGCTCTCTCCCACACACACGCACACCCCAGTTGATTAAGAATCAGAAC
CCATCTGGCTACATCAAATCAGAGCTGTCCATCAAACGGTTGTAAATAAA
AGATCTCATAAACACATGATGCCCTTGGGATCTCTCAATAGATG
back to top