CB304884

Overview
NameCB304884
Unique NameCB304884
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length540
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
CB304884_ssr47 microsatellite CB304884_ssr47:47..60.
Csv1_Contig6690 contig Csv1_Contig6690:403..942. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IaR_E07 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IaR_E07 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304884 ID=CB304884|Name=CB304884|organism=Citrus sinensis|type=EST|length=540bp
TTTTTTTTTTTTTTTTTTTTTTTCGAAAAATACTATTCATTTATTCATAT
ATATATATATAACCACATAACTCAAAGCAGAGACTCGTACATAAAACAGT
AGTCTATTCTATATTCTACAAACGTTCACAAGAAAGCCATTGAAGCAGAA
GCAAACATAGGTCTTAAATTCTATATTAGTTCTTATTTAAAAAAGATCCA
TATATATGCTTTTAAACAGGCAGCTGGTTAATTAATTCCATAGGCCGCAT
GGCGCATCTGTCTCTCATTTGCTGCAGTTACACGGGTTGCAGTTGCATGG
GTTGCACTTGCAGCCGCCGTTGTCGTCTCCCTCGTTCACTTTCTCTGGGG
CAACTTCAGGAACTACTTCAAGGCTCTCGGCGATAACATTCTTATTGTCA
CCTTCATAGGAGAAATCAGTAGCCTGAGCAGGAACACTTCCACCGGATCC
AGCCATTTTCGGATTCTTATGAAAGATTGGAACAAACAGTTGATTATATG
ATGCTTGATGTACGGCGAAAAACCACTGAAGCGCTACCCC
back to top