CB304887

Overview
NameCB304887
Unique NameCB304887
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length178
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig11676 contig Csv1_Contig11676:560..737. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IaR_E10 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IaR_E10 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304887 ID=CB304887|Name=CB304887|organism=Citrus sinensis|type=EST|length=178bp
TTTTTTTTTTTTTTTTTTCTTTTTTTTTTTTGTAAAAAACAAACAAGCTC
TAAATCATTTAATGGATATCAACTTTTGAGTACATAGTCATGCTAATTAA
TTAGCAAATTTCACTGCAAAATACGTACACTACATTACCAGATCAACTAC
ACCAAACTTAAAAGAAAAAAAAAAAAAA
back to top