CB304893

Overview
NameCB304893
Unique NameCB304893
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length605
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig4476 contig Csv1_Contig4476:692..1296. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IaR_F10 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IaR_F10 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304893 ID=CB304893|Name=CB304893|organism=Citrus sinensis|type=EST|length=605bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTATCGGTTTTCAAGAACGCTG
AGTTTAGCCGGTTTCCTAGACCTATAATATTCTAATATAAAAAAGAAATT
CACTAAACTTATCGACTTATCGAACTAACTTTTCATTGATGTATTTTTTC
ATCGAGATCCGATCCAAAAATCACGATGCCATTTTCTTGTTCCTGAATTG
AATGGGCTTCTTCCATTTTTTTAGGTTTAGGCTCTACTCCGAGTAAGGAT
TCGCCCGATTTTGATTTGCACATATAAGACAAATGACCCCAATACCACGT
CTCTTTTTTGCTATGACTTACCCCTTTTTTAATTCATTTCTTTCATGTCT
TCCGCCAAATATTTGACATATTCATCATATTTAGCATTCCGTTGATTAAC
GTTTGAGATCGCTTTTCGAATAAAGGAATCGTTTATGATATAAGTAATAA
TCATAGATATATTACCAATTGGGTTTTTCTAAACGGAGCCTGGATACCTC
ATTTTATTGGTCCAGCCAAGACGACCATAAAATTGATTTATTGCTAATAT
TAATCTGGATGCTTCCTCACGAAATAGAACTAAATGCACTTCATTGCATT
TCACC
back to top