CB304895

Overview
NameCB304895
Unique NameCB304895
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length538
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IaR_F12 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IaR_F12 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304895 ID=CB304895|Name=CB304895|organism=Citrus sinensis|type=EST|length=538bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGAGGGGGTCCCCAATCAA
AGACAAGAATAGGAATCTTCGGTTTTCCTTTTCTCCTATAACTGGTTGGT
ATTTGCAATACAACTTGAAAAAACTAGTCAAAATGTCCCCTACTGCGGTA
CACAAACTAAAATCCAAATCGTTTCAGCAAAGCAGGATACAGAAGTGCAA
TTGTGCAAAACGAATGCACAGCCAAAGCCAACGCCACAAATACTCAATCA
TACAATACAAGAGACAAAAGAGTGGGGGAGGTTGGGGGGATAAGGGGAGG
AAACCTTAACCTTAAAAATGCACTGCTGATTCAGGCCCAGGCCCACTGTG
CATGTAAACCATCTTAACCGTTCAAATTTAAACGTCTACATTCTCATCAG
ACGGCTTCGAGCGATTCTTCCTTTCCATCAACAGCCCGCACAACATACTC
TCTGATGCTGACCTCAGACGATTTATTCTTGCCAAGCAGTTAAGTGATCC
ATTCCACTCCTTCAACACCGTTGATGTTGTTGACGATG
back to top