CB304896

Overview
NameCB304896
Unique NameCB304896
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length480
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IaR_G01 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IaR_G01 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304896 ID=CB304896|Name=CB304896|organism=Citrus sinensis|type=EST|length=480bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCGAACTTGATCGCATCCAA
AAAAATCTTCGATAGCACGTGGATCGGTTAATTCAATAAGAAATGGGAGT
TCGCGCTCGATTTCGTTGGTACCGTCCAACCGAATGCAATTCAATAGTTT
CCTTATGCTTATGCATTTATGCAATTTCAATGAGGGAATTTTCAAGTTCA
ACCAACCGACTTTCAAAATATCAAGTGGGTGAATAAAAATCTTGAGAAAG
TCGTTCATTATATCTATCATTATAGACAATACCCGCCATATTATCTATGG
AGTTCGAACCTGAACTCTCTTTTTCGATTCATTATTTCTATCTCATTGGA
CCTTATTTCTTATTTTAGCATATCGACTTATGCCTAGTCTATTCTTTTTT
TGGATATATATACCCTGCTTTTTGATATATATACCCTGCCTTTCTTTACT
GGATGAATTACGCATATTTTCTTTGCACCC
back to top