CB304897

Overview
NameCB304897
Unique NameCB304897
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length253
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IaR_G02 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IaR_G02 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304897 ID=CB304897|Name=CB304897|organism=Citrus sinensis|type=EST|length=253bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGCGAAAAAGGGTTCTTTACC
TGCCCCCCGACCAAAAAAACTTTCTGATCTTTTTGCCCCGTCTTTGAAAT
AGACAGGATCGAGGCTCTATAGATTACCATGGCCGAAAGTTTGGATTTCA
TGAGGGACACTATGCCGGCCAAGGGCAGCCATTGATTTGCCCATCCATTC
TTCCGGATTCAAAGTACAGAGCAATGGAAAAGATGGGCCTTTTTTTTTCT
CCC
back to top