CB304903

Overview
NameCB304903
Unique NameCB304903
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length614
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
CB304903_ssr40 microsatellite CB304903_ssr40:40..51.
Csv1_Contig1848 contig Csv1_Contig1848:260..873. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IaR_G10 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IaR_G10 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304903 ID=CB304903|Name=CB304903|organism=Citrus sinensis|type=EST|length=614bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGTCAACTCTTTTATTTATTT
ATGGACTAGACTTAGAAGAGCTCTGCTCGTTACAACACACTTGAATCCTT
TTTATAAGCACACTAAAGGATCCTCCAACAAAACATCAATTACAATCATT
ACACAAACGATAATATTATTTAGAGGTAGTTAAATTACACAATACATTGA
CACAACTATATGACCAATCCTATGTTTATATTAGATAATACCATTAATAC
ACACATCAACTTATCTCACCGCACAATATTCAATTCGAGTACAAGTTCCA
AAACACTTGACCATCAAAAGTATGATCAGAATCCACGACATCTCCTCCGT
GAAAAACCTCTAAAAGATTAATCTCCAAAACAAGAGAACCTCCGCGCAAC
ACTTCACGATCATATTTCAATTTGTTCAATGGAACTGTAGTTCTAACGCC
ATGGAAAGGACGATCATTTTTATCATCACCTATAGGCTTATAACCATTAG
AAGAACCAGATGCAATAACACAAAGCGAGCTAGCGGGGTCCATATTATTG
ACACTTGGATTAGGTAAATTTTTTCTCCAATTACTCTCCGGCTCGTGGGG
AACAACTATCACGG
back to top