CB304904

Overview
NameCB304904
Unique NameCB304904
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length188
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10531 contig Csv1_Contig10531:801..988. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IaR_G12 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IaR_G12 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304904 ID=CB304904|Name=CB304904|organism=Citrus sinensis|type=EST|length=188bp
TTTTNNNTTTTTTTTTTTTTTTTTTTTTTTTGAACCATTTATCTCCATTC
ACATATGGGGAAAACCAAGTCTTAAAGGTCATTTACAGATTACAAACCAT
ACTGCCACTACCCGGCCACACCTTCAAGCCTAGAATTTTGCAAACCAGAC
CACTAGATGAAGCAAACTCATCAGACAAANNNTAAATT
back to top