CB305008

Overview
NameCB305008
Unique NameCB305008
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length631
Libraries
Library NameType
Flavedo Maturecdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionFLAVEDO0003_IIaR_F06 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0003_IIaR_F06 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB305008 ID=CB305008; Name=CB305008; organism=Citrus sinensis; type=EST; length=631bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTACAGTAATAAATAAGAAATGT
AAAATTAAGTAAAGGACTACACATAATCATGAAAAATCATCTTCAAAGGA
AGGTGTTAGTTTCAGCAATGGAAAACAGTCATCTTCCATTATTTCTTACA
GCTCCGAGTTTCAAACTGCAATCAGATGAACACACAATGACACTAGACAT
ATGAATACTCACACCCAAATCTGCCTATGGTTCTCCGCCAAGCTCCACCC
GCAAGTTGTCGTAGGGATAAACTTTTGGTGTAAAAGGAATCTTTGAGGCC
TTATCATTCCACACAGCCAAAGCTCCCAATGACGCGAAAAACCCTAATCC
TCCAAGTAACCAACCCAACGCTTCATACTTGCCAACGGTATCAGCGATGC
GATCGATGCAGGGCTCTGGAAATGGAGTCCCGTTGTCCCAAACCAGCTCG
TCATTAACCGAAAGGGGTTTATTAGGGACGATGTGTTTGCCTACGGGGAG
GCCCATGCCGGAGCGAAGTCGAAGAGATGAAGCGACTGACCGCCCAACGA
CGCCGTTTCCTCCCATGATCTGCGACGCCACGTTGCTCAATCTTCCTGCC
ATTTTTTCTTTTTCCTCCTCCGATTGATTTT
back to top