CB305017

Overview
NameCB305017
Unique NameCB305017
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length426
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0003_IIaR_G09 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0003_IIaR_G09 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB305017 ID=CB305017; Name=CB305017; organism=Citrus sinensis; type=EST; length=426bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGAGTCTGAGAGGAAGCTTCC
CATTAGAAAAGCAGCAGTAACAGATACACTTAATGATTAATTAACTAGCC
ATGGATCTGCAACAAACCCAGTTAAGGATTCGGAGAAGCAGCCATGGCTG
GTTTTTATTTTACAAACAAAAGCTCATAAAAAGACATCCAACAAAGCCAA
CACAAAAGACAAATAGTTCTTTTTATTGATACTACAATTTAAACGACCTC
ACAGCGCTGCTTTATTATGGGGCATGTTCACGTCTCGTAATCTTCATTAA
CAGTTACAAGGGTTGCACTTGCAGTTTGGTCCACACTTGCAGCCGCCCTC
AGCTCCGAATCCCATCTCGGACCCCTCAGAGTGCATCTTGACAGGAGCAA
CACCGAGGACGAGGGTCTCGGTGGCG
back to top