CB305023

Overview
NameCB305023
Unique NameCB305023
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length599
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0003_IVaR_A04 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0003_IVaR_A04 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB305023 ID=CB305023; Name=CB305023; organism=Citrus sinensis; type=EST; length=599bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGTTAATTTATTTATAGACTA
AATTCATGAATCTCTACTCATATTACAACACACTTGGATCCTTTTATAGA
CACAGTAGAAGACCCCACAATATTACATTATAGTCAACTCTTTTATTTAT
TTATGGACTAAACTTAGAAGAGCTCTGCTCGTTACAACACACTCGAATCC
TTTTTATAAGCATACTAAAGGATCCTCCAACAAAACATCAATTACAATCA
TTACACAAACAATAATATTATCTAGAGGTAGTTAAATTACACAATACATT
GACACAACTATATGTCCAATCTTATGTTTATATTAGATAATACCATTAAT
ACACATATCAACTTATCTCACCGTACAATATTCAATTCGAGTACAAGTTC
CAAAACACTTGACCATCAAAAGTATGATCAGAATCCACAACATCTCCTCC
GTGAAAAACCTCTAAAAGATTAATCTCCAAAACAAGAGAACCTCCGCGCA
ACACTTCACGATCATATTTCAATTTGTTCAATGGAACTGTAGTTCTAATG
CCATGAAAAGGACGATCCTTTTTATCATCACCTATAGGCTTATAACCAT
back to top