CB305028

Overview
NameCB305028
Unique NameCB305028
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length141
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0003_IVaR_A10 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0003_IVaR_A10 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB305028 ID=CB305028; Name=CB305028; organism=Citrus sinensis; type=EST; length=141bp
TTTTTTTTTTTTTNNTTTTTTTTTTTTTTTTGNNACAGGGAAAGAAAAAT
ACTATTCATTTATTCATATATATATATATAACCACATAACTCAAAGCAGA
GACTCGTACATAAAACAGTAGTCTATTCTATATTCTACAAA
back to top