CB305062

Overview
NameCB305062
Unique NameCB305062
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length264
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig8594 contig Csv1_Contig8594:780..1043. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionFLAVEDO0003_IVaR_E09 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0003_IVaR_E09 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB305062 ID=CB305062|Name=CB305062|organism=Citrus sinensis|type=EST|length=264bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCCATATAATTACATTTGCC
TAATTCCAAAAGTTTCGGCTCCACCCAATGTCGGTCGTTGTTGGCTGCCA
CAACGATATAATCGTCTTCAATTTCTCTGCCGCAATTTCAAAATTACTTC
AGCCTCATACGACCGCACTTCAATTAGCAATTAATTTCATGATCTGATTT
TACTATGTGGGGAACAGATTTCAAGAATTAATGGGTTTTCGCAATGAATT
CGACCATGTCCCCC
back to top