CB305067

Overview
NameCB305067
Unique NameCB305067
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length344
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0003_IVaR_F05 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0003_IVaR_F05 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB305067 ID=CB305067|Name=CB305067|organism=Citrus sinensis|type=EST|length=344bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCGAATAACAAATTGTAT
ATATGTTATTGGCATAAACCATGTCAGAGAATCTAAATGATCATTACTCA
TAAATCTCATATATTGTTTCAATGAAAACATGGTGTTTAACAAGAATCCA
TCTTACAAATTAAAGTTAATAACCCATTTCAGCTCAAAAAGAGAGAAAAA
GAGAGCAGTCCCAATCTTGTAGCCACATGAAGAGAGCTGTAAACTCAAAC
TTACATGCAAATGCTGGTGGAACTAACCAAACAAGAGCCATATAAGTGGA
TCCAATTTTGTAGTAGTTTCCTAATGCTAGAAGAATGAGCCACT
back to top