CB305072

Overview
NameCB305072
Unique NameCB305072
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length423
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
CB305072_ssr183 microsatellite CB305072_ssr183:183..196.
Csv1_Contig11246 contig Csv1_Contig11246:10..428. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionFLAVEDO0003_IVaR_F11 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0003_IVaR_F11 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB305072 ID=CB305072|Name=CB305072|organism=Citrus sinensis|type=EST|length=423bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTATAGAGAAACTGATACATAA
TTTTATTCACCAAAGTCACAAGACATAACATTGATCATTCTACAAAAATT
AAAGACACATCCACCAAAAGGCTAATAATATTATAAGCACAGTTGCTCCT
TGACAAGAAAAGACACAACAATACAATTGAAAATATATATATATATAGAG
ATGGCGGGTGGTACATGCCCTCCACTGCCAGCCAATTTCTGTCTCTGCCA
ATTTCAAAATTAGAGCAGAGCAGAAACCACCGTACTAGAATACATGATCA
AAATATAAAACGCCAAAGGGCCATTTCAAAATAAGCCCTTTGTCATTTTG
ATACCAGATTCAACTAACGCTATTACACTCATTATTTTATACTTGAAAAT
GTGAAAAAAAAAAAAAAAAAAAA
back to top