CB305081

Overview
NameCB305081
Unique NameCB305081
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length496
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0003_IVaR_G11 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0003_IVaR_G11 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB305081 ID=CB305081|Name=CB305081|organism=Citrus sinensis|type=EST|length=496bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTCGAATTCAACCTGTGACTATT
CATTCACTGCTAGTAATTGTTATCCATTTATATTCAACGAATTCAACTCC
CCCCGGATTTTAATTCCGCACCTGAAGCTGATTCTATAAATATATATGGA
GGATAATTTACATGGACTTATCGAGTCTCTTCTTGGTTTCCTCGGCGTTA
TCAGCAGCTTCCACCTGCATCTTCCAAATCTGCTGATCAGCTTCCGTTGC
TTCCCTCTCGTTTCTCGCTGTTGCCTTCTTCGCCTGTCCGATAAACCAGG
CTTTGACATAGCAGAAAACTTCCTGCAAAGAAGTTTTGAAGAATAAGCAA
TCTTTCTTCACGCGAGACAGAGGTGACGGTTCCTGATTTCTCTTCGTCGT
CTCTGTGGTTTGTGCTGGTGAAGATTTTGCCGCCTCCATGTTCCTATTTT
TTTTTCCCCCTCTTTACTCCAATTTATTTTTAATTTTTAATTTCCC
back to top