CB322083

Overview
NameCB322083
Unique NameCB322083
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length211
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10348 contig Csv1_Contig10348:960..1171. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Mature leaf blade cDNA subtraction librarycdna_library
Properties
Property NameValue
Genbank descriptionEST0190 Mature leaf blade cDNA subtraction library Citrus sinensis cDNA clone 24LB005, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB322083 ID=CB322083|Name=CB322083|organism=Citrus sinensis|type=EST|length=211bp
ACAAATTTGATTTGTATTNTAGAGAAAATGAGTTGCATTATTATCCCTGT
ATATTTTGCTGTCATGCTTCTCTGTCTCGGTTAAGAAGATTGTCCATCAT
CAGCATAAGCATGTGTAATCTTATCATGGAATCATAGTTGTATTGCTGCC
ATTATCATTCTTGGATAGTGTTCTTTACTAATTTATATGACCAAAAAACC
TCGGCCGCGAC
back to top