CB322086

Overview
NameCB322086
Unique NameCB322086
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length403
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CB322086_ssr300 microsatellite CB322086_ssr300:300..323. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig2793 contig Csv1_Contig2793:264..666. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Mature leaf blade cDNA subtraction librarycdna_library
Properties
Property NameValue
Genbank descriptionEST0194 Mature leaf blade cDNA subtraction library Citrus sinensis cDNA clone 24LB009 similar to unknown Arabidopsis protein (acc# NP_179485), mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB322086 ID=CB322086|Name=CB322086|organism=Citrus sinensis|type=EST|length=403bp
ACTTCCACTTTGCGTAAATATGATGTTACTGGGTTACGGAGGCGCTGTAG
TTGCTGGGGCAACTTCAACTTTGATGATAAGCAAGCTTGTCACTATAATT
GGGCACATCATACTTGCTCTCATGATGTGGCTTCGATCTCGAAAAGTTGA
TCTCGATAATTTTGATTCATAATTTGGTTTTTACATGTTCCTTTGGCAGT
TAAATTATGTTGAATACATCCTTATCCATTTTCTACGCTGAGAACTGAGA
AGGAAACAACCGTTCAAATTCATGGAACAAATAACAAGAGGCAGTGTTCC
CTACCTACCTACCTACCTACCTACTTAGTTTTGTTGTGTATGTGTTTACA
CATGTTATATTGTTTAGCATTTTAATAATGAGTCATGAGGGTATACTTGT
AGC
back to top