CB322090

Overview
NameCB322090
Unique NameCB322090
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length149
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig6873 contig Csv1_Contig6873:541..689. BLAST: Citrus Unigene V1 Contigs to Populus V2 proteins
Libraries
Library NameType
Mature leaf blade cDNA subtraction librarycdna_library
Properties
Property NameValue
Genbank descriptionEST0198 Mature leaf blade cDNA subtraction library Citrus sinensis cDNA clone 24LB014 similar to cytochrome P450-like protein (acc# BAA10929), mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB322090 ID=CB322090|Name=CB322090|organism=Citrus sinensis|type=EST|length=149bp
GCTCCCACTTATACTACACCTCTCAAGTCATTTCACAAAGTCGGACTAGA
GTCAAGCTCAACAGGGTCTTCTTTCCCCGCTGATTCTGCCAAGCCTGTTC
CCTTGGCTGTGGTTTCGCTGGATAGTAGACAGGGACAGTGGGAATCTCG
back to top