CB322091

Overview
NameCB322091
Unique NameCB322091
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length201
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Libraries
Library NameType
Mature leaf blade cDNA subtraction librarycdna_library
Properties
Property NameValue
Genbank descriptionEST0199 Mature leaf blade cDNA subtraction library Citrus sinensis cDNA clone EST015 similar to disease resistance protein (acc# NP_199459), mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB322091 ID=CB322091|Name=CB322091|organism=Citrus sinensis|type=EST|length=201bp
ACTCCAAGTTGCTGACGAAACTCCCAGACCTCTCCCTGGCCCGAAATCTT
GAGATATTGGATTTAGGCTACTGTTCAAGTTTGACAGAGACTCACTCATC
TATTCAATATCTAAATAAACTTGAAGTCCTTGATCTAGACCGCTGTGAAA
GTCTGACCAGTCTTCCAACTAGCATTCATTCGAAGTATCTCGCGCGACTT
G
back to top