CB322097

Overview
NameCB322097
Unique NameCB322097
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length142
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig8426 contig Csv1_Contig8426:920..1061. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Mature leaf blade cDNA subtraction librarycdna_library
Properties
Property NameValue
Genbank descriptionEST0206 Mature leaf blade cDNA subtraction library Citrus sinensis cDNA clone 24LB022, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB322097 ID=CB322097|Name=CB322097|organism=Citrus sinensis|type=EST|length=142bp
CTTTATGGACCATCAAGGATGTCTTTACTTCAGAGCATGTGCTATGGAGA
GCTATCTTTCTTCCCTCTTCTTTATTGCTTGCCTCTATGGTGTCTTGCTA
CTCTTCCTCAGTTGTGTCTGTTAAATGGCATCTCTCTGTACC
back to top