CB322100

Overview
NameCB322100
Unique NameCB322100
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length360
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12612 contig Csv1_Contig12612:555..915. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Mature leaf blade cDNA subtraction librarycdna_library
Properties
Property NameValue
Genbank descriptionEST0209 Mature leaf blade cDNA subtraction library Citrus sinensis cDNA clone 24LB040 similar to endo-beta-N-acetylglucosaminidase (acc# BAB09989), mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB322100 ID=CB322100|Name=CB322100|organism=Citrus sinensis|type=EST|length=360bp
ACCCTGAGAATCTGAAGCAAATTTAACATATTGTGCCTCAACGAGCCATG
AACTAGACAGAGGGAAGTCTGAGTTCTGTCCACTAGTTTTAATAGAAATA
TCCCCAAGGATTGCAAAGTATTCTGCCGGAGTGTGAACTGATGCATTATC
TTGAACATTTGATGTGGACTCTAGAGTCCGCCTGCTAGGCTCTGGCATGT
AGCATACAGCACTGATTCCTGTTATTGCGTATCCATCCATTATAATTCTA
GCTTCCCATGTGGCCCATTCTGTGGTAGTTTCTAGCATTTTAACTTGGCG
TGGAACAATCAATTCACTGAATTTGGTTGAAGATTGGTCAATTCTACGGG
ATGCAAGAAG
back to top