CB417312

Overview
NameCB417312
Unique NameCB417312
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length392
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2634 contig Csv1_Contig2634:57..448. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Mature peel (flavedo) cDNA subtraction librarycdna_library
Properties
Property NameValue
Genbank descriptionEST0388 Mature peel (flavedo) cDNA subtraction library Citrus sinensis cDNA clone 6P033 similar to unknown Arabidopsis protein (acc# AAO42915), mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB417312 ID=CB417312|Name=CB417312|organism=Citrus sinensis|type=EST|length=392bp
GAAAAACTCAGAGCCACCCCACTTCTTCCAATATACACATATTCAAAATC
CCATATCTCTGTATATTCGAAGTTGCAGAATCAAAAAATAAAAAATAAAA
AAGATTGAAACATGAGTGCAGCAGCAAGAAAGGCTTGGTTTGTGGCAGCG
AGTATTGGGGCTGTTGAGGCATTGAAAGATCAAGTGGGAATCTGCAGGTG
GAATTTTATTATAAGGTCCGTGCATCAACATGCAAAGAACAATTTGAGGT
CATCGCTCAATCAAGCCAACAAGGCCATCTCTTCATCTCCAGCTTCCAGG
GAGATTTTTAATAGTAATAATTTTTATAACAAGGCGAAGAAGCCCGAGGA
AAAGGTCAAAAGGGTCATGGATTTGAGCTGCTGGGGTCCTAG
back to top