CB610475

Overview
NameCB610475
Unique NameCB610475
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length434
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9996 contig Csv1_Contig9996:496..928. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Mature Albedocdna_library
Properties
Property NameValue
Genbank descriptionALBEDO0003_IaF_H04 Mature Albedo Citrus sinensis cDNA clone ALBEDO0003_IaF_H04 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB610475 ID=CB610475|Name=CB610475|organism=Citrus sinensis|type=EST|length=434bp
GGGGTACCTGGATATAACAGGAGTTCAAACCTACATCATAAACAGCGCAA
GAATTGTCTTCTTGAACGAAAGACCTCAGCCCAGGCCTGGTAAAGGCGTC
ACAAATACTTGTCTTGTTTGCGAGCGCAGCCTCCTTGATTCCTTCACTTT
CTGCTCCCTTGGCTGCAAGATTGCGGGAACATCAAAGAATTTCAAGAAAA
GGAAAATGTGCAAGGAAATGGATCAAGGATCGGATGCTGAGATTAGCAGC
AATAACGGGAGTTCAAAGAGCAGGACACAGAGTTTTTCGCCGTCGACGCC
GCCGCCGACGGCCGTGAGTTTCAGGACTGCCAAGAGGAGAAAGGGGGTTC
CTCATAGAGCTCCAATGGGAGGTTTACTCATTGAATACTAGAATAGTAGT
TAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top