CB610484

Overview
NameCB610484
Unique NameCB610484
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length120
Libraries
Library NameType
Mature Albedocdna_library
Properties
Property NameValue
Genbank descriptionALBEDO0003_IaF_E12 Mature Albedo Citrus sinensis cDNA clone ALBEDO0003_IaF_E12 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB610484 ID=CB610484|Name=CB610484|organism=Citrus sinensis|type=EST|length=120bp
GGGGGTTTGTAAGTGCTTTTAANNTAATAAATACTAAGGTGAAACTTTTA
TTGTTACTCGGTATTTGTAGTTTTCTGGATAGAAAGGAAAGCCGCTACAA
CCCAAAGATGTNACCTACCA
back to top