CB610486

Overview
NameCB610486
Unique NameCB610486
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length183
Libraries
Library NameType
Mature Albedocdna_library
Properties
Property NameValue
Genbank descriptionALBEDO0003_IaF_F02 Mature Albedo Citrus sinensis cDNA clone ALBEDO0003_IaF_F02 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB610486 ID=CB610486|Name=CB610486|organism=Citrus sinensis|type=EST|length=183bp
GGGGTAAAAAAACAGCGGTGGGTGGCAGATCACTACGATCACGAAATGAT
AAAAAAGTTGCTGCTATACCTCTGCGTCGTTCTGCTAGGAGAGCTAAACT
TGTCTCAGTGCAAAATAGAAAGCATGCAGGGCGCAAGAGAGGGAGGCCAA
AATCCAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top