CB610487

Overview
NameCB610487
Unique NameCB610487
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length489
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13672 contig Csv1_Contig13672:117..605. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Mature Albedocdna_library
Properties
Property NameValue
Genbank descriptionALBEDO0003_IaF_F03 Mature Albedo Citrus sinensis cDNA clone ALBEDO0003_IaF_F03 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB610487 ID=CB610487|Name=CB610487|organism=Citrus sinensis|type=EST|length=489bp
GGGACTCAAGCTCACCTACTCACTTTTGATTACGGTTCTCCAGAAGCTAA
CAGAGATCGTTTCTGCTTTGAAGAAAATGGAAACTCCTTACACAGGTAAC
AAAGAATGGTCAGAGGGTACACATGTTAATATAGGAGTTAGTATGTTTGA
TGATGAGAAAATAAACAACAATGATCTTGATCTTTTTACTGTCCCTCAAT
ACGGGAGGCACCCTGACTACACTGGTTAAGTGTTACAGCATTATACTTTT
CTATTATGTTTAGTGAAATAAAAGGATGGATAATGTTATTATCCATCAAT
GATGTGAATACAAGGTTGGTTTAGTCAACTACTAAGATCTTGTGGGATAG
ACAAAAAACTGCTTTCTTTAGCACATGTATTTTGTCGTCCTTAATTAATA
AATAAAATTATTGTGTGTATGAGTTGACTGAATTATTTTGGCAATAGATA
TAAAATTGTATAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top