CB610488

Overview
NameCB610488
Unique NameCB610488
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length136
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2579 contig Csv1_Contig2579:407..540. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Mature Albedocdna_library
Properties
Property NameValue
Genbank descriptionALBEDO0003_IaF_F05 Mature Albedo Citrus sinensis cDNA clone ALBEDO0003_IaF_F05 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB610488 ID=CB610488|Name=CB610488|organism=Citrus sinensis|type=EST|length=136bp
GGGGATCACAGCAAAGCAATGCAAGTTTCGTACAATAAAGAGCCCTCTAT
TTCCAGTTTTAAATTCCAAGTTCTAAGCTCAATCGACATGTCGGACACCT
GCGGCAACTGCGACGATCNTGACAGGAGCCAGTGTG
back to top