CF417084

Overview
NameCF417084
Unique NameCF417084
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length671
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionUSDA-FP_115000-014 Citrus sinensis: Insect-damaged immature leaves/stems from field collected Valencia orange Citrus sinensis cDNA clone IDFL-001_B5 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF417084 ID=CF417084|Name=CF417084|organism=Citrus sinensis|type=EST|length=671bp
ATCTAATCAAGGCTATGATGGGTGTCACGAGGTGTATTGTTGAGTTCAAG
GACATGCCATCCAATTACATTACGCAGGATGCTCCAGAATTTTCCTCAGC
CATGGCTCATATCCCAATCGCCGTGTATTGGACCATCAGGAGCGTTGTTG
CTTGTGCTACTCAAATTACTACTCTCACAGGCATGGGCCATGAGTTTGTA
ATATCAACCTCTGAGGCATGGGAACTATCCACCTTGGCTCATAAACTCAA
AAACATACATGAATCTCTGAAGAAGCTGATGGCTACATGCTACCGCCACA
TAGAGGAAAAGAAGAGTAATGAAGCCTATCAGATGCTAGTCAAGCTCTTT
GACTCAATCCACATTGATTAACATGAAAGTTCTGAAGGCCTTGATTTATG
CCAAGGATGATTTGCAACCCCTTGTTGATGGTTCAACTAAGAGAAGGGTT
NAATATTGAGGTGCTGCGGGAGGGAAAAATGTGTTGCTGCTCATTTCCGA
CCTAGACATTTCCCAAGAGGAGCTTTCAATTCTGGAACAGATTTATAATG
AGTCAAGGCTTCATTTAACAAGGCAAGAGAGCCACNTATGNAGGTTGTAT
GGGATTCCAATTGTGGACCATTTTATCCCACTGGGATGGACCCAACGCAG
AAAAAATTTGAGACCCTACAG
back to top