CF417085

Overview
NameCF417085
Unique NameCF417085
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length646
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Homology
BLAST of CF417085 vs. ExPASy Swiss-Prot
Match: YLW2_SCHPO (Uncharacterized protein P8A3.02c OS=Schizosaccharomyces pombe GN=SPAP8A3.02c PE=2 SV=1)

HSP 1 Score: 67.0106 bits (162), Expect = 9.508e-11
Identity = 43/116 (37.07%), Postives = 58/116 (50.00%), Query Frame = 2
Query:   44 LPSDL---LWREPLFDQLIVNVYQPGEGICPHVDLMRFEDGIAIVSLESSCVMHFTQVKEASATGEGRIDNPHAVKIPVYLTPGSLVIMSREARYLWKHEINRKQGFQMWGRGSAK 382
            +PSD    LW+    + +I+ VY PG+GI PH DL  F DG+AI S  S+  M FT  +               +K  + L  GSL++MS  ARY W HEI  + G  +   G  K
Sbjct:  101 IPSDFKQRLWKGQDAEAIIMQVYNPGDGIIPHKDLEMFGDGVAIFSFLSNTTMIFTHPE-------------LKLKSKIRLEKGSLLLMSGTARYDWFHEIPFRAGDWVMNDGEEK 203          
The following BLAST results are available for this feature:
BLAST of CF417085 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 1
Match NameE-valueIdentityDescription
YLW2_SCHPO9.508e-1137.07Uncharacterized protein P8A3.02c OS=Schizosaccharo... [more]
back to top
Properties
Property NameValue
Genbank descriptionUSDA-FP_115000-015 Citrus sinensis: Insect-damaged immature leaves/stems from field collected Valencia orange Citrus sinensis cDNA clone IDFL-001_B7 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF417085 ID=CF417085|Name=CF417085|organism=Citrus sinensis|type=EST|length=646bp
TGATGACTTGCCTATAAATGATGGGGACAAGGACGTCTGCATTTTGCCAT
CAGATTTGTTATGGAGAGAGCCACTATTTGATCAATTAATTGTAAATGTT
TACCAGCCAGGTGAGGGCATCTGTCCGCATGTTGACCTAATGCGGTTCGA
GGATGGAATTGCCATTGTCTCCCTAGAGTCATCATGTGTGATGCATTTCA
CCCAAGTCAAAGAAGCCTCTGCGACTGGAGAGGGAAGAATAGATAACCCA
CATGCGGTAAAGATTCCAGTTTACTTGACTCCAGGATCTTTAGTTATAAT
GTCCAGAGAAGCTCGCTACCTTTGGAAGCACGAGATAAATCGCAAACAGG
GTTTTCAGATGTGGGGAAGGGGAAGTGCTAAATCAGAAAAAGCGAACTTC
CATAACCATGCGAAAGCTTTGCCATGTCGAGTAGCAGCTTTACATTCAAA
TTTTGGCGGTGGCGCATATATTTGTTCTTTCATATTCAAGTTTATTCTTT
GCAAAACCAATAGAAGGTGCGTAATGCGTGCATTGCAACATCATTAGAAA
TTGAGGCGACTACCTATATCCACTGTATTGGGATGCTTCCAATCTCTAAT
TGTAAGCCGTCGTGCACGTCTCAATTACCAACCAAAATTATGCTTT
back to top