CF417093

Overview
NameCF417093
Unique NameCF417093
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length648
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig11941 contig Csv1_Contig11941:40..684. BLAST: Citrus Unigene V1 Contigs to Trembl
Properties
Property NameValue
Genbank descriptionUSDA-FP_115000-023 Citrus sinensis: Insect-damaged immature leaves/stems from field collected Valencia orange Citrus sinensis cDNA clone IDFL-001_C3 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF417093 ID=CF417093|Name=CF417093|organism=Citrus sinensis|type=EST|length=648bp
TTCTCATAGTTATATCACCAAAGGAAAACGAAAAATGTCTGGCTGTGGTG
GAAACTGTGGCTGTGGTTCTAGCTGCAAGTGCGGCGGCGGCTGCGGCGGT
AGCTCCATGTACCCTGACTTGAGATCCTTTGAGAGCACCACCGTAGCCAC
CGAGACCCTCGTCCTCGGTGTTGCTCCTGTCAAGATGCACTCTGAGGGGT
CCGAGATGGGATTCGGAGCCGAGGGCGGCTGCGGCTGCAAGTGTGGACCA
AACTGCAAGTGCGACCCTTGTAACTGTTAATGAAGACTACGAGACGTGAA
CATGCCCCAGAATAAAGCAGCGCTGTGAGGTCGTTTAAATTATAGTATCA
ATAAAAAGAACTATTTATCGTTTGTGGTTGGCTTTGTTGGATGTCGTTTT
ATGAGCTTTTGTTTGTAAAATAAAAACCAGCCATGGCTGCTTCTCCGAAT
CCTTAAACTGGGTCTGTTGCAGATCCATGGCTAGTTAATTAATCATTAAG
TGTCTCTGTGACTTTGTGTACGAAGCGTATCTGTTACTGCTGCTATTCTA
ATGGGAAGCTTCCTCTCAGACTTTTATCTATATTGTAAAATGTGNTTTGG
NTTATGTACTGTATAATAAATTTACAACGTTGAAAAAAAAAAAAAAAA
back to top