CF417200

Overview
NameCF417200
Unique NameCF417200
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length616
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13084 contig Csv1_Contig13084:244..859. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_115000-130 Citrus sinensis: Insect-damaged immature leaves/stems from field collected Valencia orange Citrus sinensis cDNA clone IDFL-002_E11 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF417200 ID=CF417200|Name=CF417200|organism=Citrus sinensis|type=EST|length=616bp
TCCACCGCCGCTCAAACGCTTTTCTCTGATTCGTGATCCTCCTAACCGGT
TTTCTGTCATTTGCTTCTCTTCTGTTCCAGACGGTATGGATACTGCAGCA
AGTACAAGTCTATACCCATTTCACAGAAGTAAAACCATTCACCTGGTGAG
GCATGCTCAGGGTATTCACAATGTANAAGGAGAGAAGAACCATGATGCTT
ACTTGTCCTATGATCTTTTTGATGCACATCTTACCCCACTTGGCTGGCAG
CAGGTCAGTAATCTGCACAAGCATGTTCATGAAACTGGGCTTGCTAAGAA
AATTGAGTTGGTCATCACTTCCCCTTTGTTAAGGACCATGCAAACAGCAG
TAGGAGTCTTTGGTGGTGAAGGGTATGCAGATGGGATAGATGCACCTCCG
TTGATGGTGGCTGATGCAGGGAACAGCAACCATGCTGCAATATCAAGTCT
AAATTCTCCACCATTTATTGCAGTTGAGCTTTGTCGTGAACACTTGGGAG
TTCATCCGTGTGATAAGAGAAGAAGCATCACTGAGTATAAGTCTCTTTTT
CCTGCTATTAACTTTTCACTGATAGAGAGCAATGATGACATTTTGTGGAC
GGCTGATGTCAGAGAG
back to top