CF503818

Overview
NameCF503818
Unique NameCF503818
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length368
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10290 contig Csv1_Contig10290:344..711. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-305 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-10_B06 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF503818 ID=CF503818|Name=CF503818|organism=Citrus sinensis|type=EST|length=368bp
TTCCTTATACTTGCTTTGGCCACAAAACCTCAGTTGGGCGCCTCAGAATC
TGAACCTATCTTAGATGTCTATGGCAACCAGGTGGACTCCAGCCACAGGT
ATTATCTTGTCTCAGCACTCTGGGGAGTTAAAACCGGCGGTGGAATTAGC
GCGGACAAAGGCAAAAATGGACAGTGTCCAACGGATGTTATCCAATTAAG
TCCTAAGGACAAAAGGGGAAAGAATTTAGGTTTACTTCCGTATGACAATT
CCACAATTGTCCGGGAATCCACTAATATTAAATTGAAATTCTCAAGAGTT
TCTTCTCTTCAGCAGTGTAACAAAGATTCGTTGTGGAAAGTTGACAACGA
TAACGCTTCATTAGGAAA
back to top