CF503822

Overview
NameCF503822
Unique NameCF503822
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length422
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-309 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-10_B10 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF503822 ID=CF503822|Name=CF503822|organism=Citrus sinensis|type=EST|length=422bp
CAAAATCATTGCTCGATTCCTTCACTTGGAAAAGGTCACCGGTGCCGGCG
AAAAGAGAATACATGAACTAGCCTCAATCACGACTTTGGAATCACTACCC
ACGCCTGCTAAAAATTCTCTTTTGTCGATTTCGAATCATCCAAGAAAAGA
AAGGATGCAAGTGGGTTATTTCTCAAACCATTTCCCCATTATTACACATT
GAGTGAGATCTTTGGCCGTGATAGAGCTAATGGAGCAAATGCTGGCAATG
CTGATGATGACGAAGAAGAGGTACGTCATGAAGACAATTTTAATTTCACC
TTAGGAAATGATTCCACTCATGAGACTTTTATGGAGAATATTCTTGATGA
TATGTCACACACTCCACAATCACATGCACATGCTAATGAAAATGAAAGTG
TTCCAAGTAATTCCAGCCATCC
back to top