CF503823

Overview
NameCF503823
Unique NameCF503823
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length364
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9585 contig Csv1_Contig9585:144..507. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-310 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-10_B11 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF503823 ID=CF503823|Name=CF503823|organism=Citrus sinensis|type=EST|length=364bp
CAACTTAACTACTTTCGAACTTTGATTCCCGTAAGCAGAGATCTTTCTGA
TTTGAAGAACATGGAAACCACCTGCGCAGGTAATAACTGGTCAGAGGGTC
TTCTGCTTCCTCCGTTTGGCAGTATTGCTGATGATGATGTCATGAACGAC
AATCTTGATTTTCTTAATGTCCCCCAATATGGAAGAAACCCCGACTACAT
GGGTATAGTGCAGCACTGCTTTTTTTTTTTTCTGTTTTGTTTAATTAAAT
AAATGATAGGTATACTATTACCTATCAATCATGACAATGTTTTAGTATGG
TTTAGTTCAACTTATAAGATTTCTTGAGACGTACAAGCAATCTTTTTGTT
TACTTTTGAGCTAA
back to top