CF503852

Overview
NameCF503852
Unique NameCF503852
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length117
Alignments
Feature NameTypeLocationAnalysis
CF503852_ssr1 microsatellite CF503852_ssr1:1..10.
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-339 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-10_E05 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF503852 ID=CF503852|Name=CF503852|organism=Citrus sinensis|type=EST|length=117bp
AGAGAGAGAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTTTAGAATATA
AACATGGTGTTTGCTTGTTGAATGATCTTATATCAATGCCTTGTCTAGTA
TCATGCAGTTACAGCAT
back to top