CF503853

Overview
NameCF503853
Unique NameCF503853
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length307
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1735 contig Csv1_Contig1735:20..326. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-340 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-10_E06 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF503853 ID=CF503853|Name=CF503853|organism=Citrus sinensis|type=EST|length=307bp
TAGCTATCCTTCAAAAAAATAAAGAAAATGAAGACTTCATTAGTAGCAAA
ACTCTCCTTCCTTATCCTTGCCTTGGCCACAAAAGCTCAGTTGGGCACCT
CAGAATCTGAACCAATCTTAGATGTCTATGGCAACAAGGTCGAATCCAAC
CTCGAGTATAAGCTTCTCGAAGTCAAAAATGGCACTAGTGGTGGATTCAG
TATACATGGAGGCACAAATGGAGAGTGTCCGTTGGACGTTGTCCAACTAA
GTTCTCCTACGGAAAGGGATCATTATGTAAGATTATTACCGTTTGACAAT
TCTACAG
back to top