CF503867

Overview
NameCF503867
Unique NameCF503867
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length377
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9416 contig Csv1_Contig9416:401..777. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-354 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-10_F10 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF503867 ID=CF503867|Name=CF503867|organism=Citrus sinensis|type=EST|length=377bp
ATTCAAGCATGTCAGATTCCGGCGGCTTTGATTCCCATCCTCATGTAGCT
CTCATCCCAAGTGCTGGCATGGGCCATCTAACGCCCTTTCTTCGACTTGC
TGCATCGCTTGTTCAGCATCACTGTCGCGTCACCTTAATAACCACTTACC
CCACTGTCTCACTTGCTGAGACTCAACATGTTTCTCACTTTCTATCGGCT
TATCCTCAGGTCACCGAAAAGCGGTTTCATCTCCTCCCTTTTGATCCCAA
TTCAGCCAACGCTACTGACCCTTTCTTGCTCCGGTGGGAAGCCATTCGCC
GCTCAGCTCACCTTCTTGCTCCTCTGCTTTCTCCCCCGCTCTCTGCTCTC
ATCACAGATGTGACTCTGATCTCCGCC
back to top