CF503869

Overview
NameCF503869
Unique NameCF503869
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length433
Alignments
Feature NameTypeLocationAnalysis
CF503869_ssr126 microsatellite CF503869_ssr126:126..137.
Csv1_Contig6118 contig Csv1_Contig6118:141..573. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-356 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-10_F12 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF503869 ID=CF503869|Name=CF503869|organism=Citrus sinensis|type=EST|length=433bp
CGCCGAAACAAAAATTCAAAAATCCAAACTTTGTTTCGGTTTTGGTTTTG
CATTTGATCAATTAATCAGTCTCTCTCTTCCTCTTCCTCTCCATGGCGTC
GCTTGGCATTCATTACGGCGGTGGTGGAGGAGGAGGAGCAGGAGCGACGT
TTTCGTCGAACCGCCGCGGAACGATTACGAAAATTCGTTATCCGACTGCG
TCATTGAATGTGACGCCGGCGATGAGCGAAAATAGGAAATGTCAGGCTAT
GCCGATTTCGATATCGGCCTCGCGTGCGGATATTGATCTGGTGGAACCGA
AGCGGAAACAGGAGCGGAGCGTTTCGACCGAGAATGTGATAGACAAGTGG
ATGAAGGATTCCGTCGTGGAGATCGTCAAGAACTTACGTGAAACGCCGCT
ATTGGTGCACGTGTATTCGGACAGCGGCAGCGG
back to top