CF504028

Overview
NameCF504028
Unique NameCF504028
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length132
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig6312 contig Csv1_Contig6312:1155..1286. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-516 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-12_E06 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF504028 ID=CF504028|Name=CF504028|organism=Citrus sinensis|type=EST|length=132bp
TTTTTTTTTTGTCCTAAATAAAGGATTATATAAAATAAAAAGGAAACTGA
GTCTACAAAAAGCATTAAGAAAATAAAGCAAACATAACCATAAACGTCAA
AATCCTAAGTTATAGCACAAATGACAGTGCAC
back to top