CF504047

Overview
NameCF504047
Unique NameCF504047
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length445
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-535 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-12_G06 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF504047 ID=CF504047|Name=CF504047|organism=Citrus sinensis|type=EST|length=445bp
ATTCAGAATCCGGAGGGCCAAAAGTCATAAGATTAAACTTTTAAGAGTGT
AAACTTTTAAGAGTCGCAATTAAAAAAAAAAAGAGTAAACATATTAAAAT
AAGGGTAAAATATCAAGTTGACAAAATCATAGGGCCAATTCTTAAAAGAG
TTATTAACAACTTAATATGTGTTTTTTTTTTTTTTTGGTGTTTTCGCTAT
TGAGTATACTTAACGACACGACTGGTGATTTCATTTTTCTGCAGAATCTG
GCTATTAAATTATATATAATCGGTTCACATATACGCATATTTTTCAGGTG
ATAGGAGAAAAGGATAATGAAGCAGCGAATCAGGAACAACAAATTAATAA
TAAGATGCCTCTCCTTGTCTATGTTGCTCGCGAGAAAAGGCCTTCTCATC
CACACAATTTCAAGGCTGGAGGCTTAAACGTTCTTCTTCGGGTTT
back to top