CF504048

Overview
NameCF504048
Unique NameCF504048
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length438
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10290 contig Csv1_Contig10290:291..728. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-536 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-12_G07 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF504048 ID=CF504048|Name=CF504048|organism=Citrus sinensis|type=EST|length=438bp
GCTACCTCAAAAAAAATAAACAAATGAAGACTTCCTTAGTAACAACACTC
TCCTTCCTTATACTTGCTTTGACCACAAAACCTCAGTTGGGCGCCTCAGA
ATCTGAACCTATCTTAGATGTCTATGGCAACCAGGTGGACTCCAGCCACA
GGTATTATCTTGTCTCAGCACTCTGGGGAGTTAAAACCGGCGGTGGAATT
AGCGCGGACAAAGGCAAAAATGGACAGTGTCCAACGGATGTTATCCAATT
AAGTCCTAAGGACAAAAGGGGAAAGAATTTAGTTTTACTTCCGAATGACA
ATTCCATAATTGTCCGGGAGTCCACTAATATTAAATTGAAATTCTCAAGA
GTTTCTTCTCTTCAGCAGTGTAACAAAGATTCGTTGTGGAAAGTTGACAA
CGATAACGCTTCATTAGGAAAGCAGTTTATAACAATCG
back to top