CF504127

Overview
NameCF504127
Unique NameCF504127
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length246
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-615 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-14_B07 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF504127 ID=CF504127|Name=CF504127|organism=Citrus sinensis|type=EST|length=246bp
CTCAAATGGGCTGCCTCTTTGCCACTCTTTTGGTAGTATCAGTCTCTCTT
AGCTACTTGCCGTTAGAAGCCTCCGCAAACAAATACTACTACACATCTCC
TCCCCCTCCCAAGTACAAGTCTCCACCACCACCCCCGCCACCGGTTCACA
ATTCTCCACCACCACCCCCGGTTTACCTGCCCCCGCCACCTCCTCCACCA
GTCTACGTGCCTGCTCCGGCACCAACTCCAATTTTCCCTTCTCCGC
back to top